Table 2: List of primers used for screen discogenic markers. Annealing temperature was 61C and two-step protocol with 40s, 10s at 95C and 30s expansion per cycle, 45 cycles in total

Gene Abbreviation Full name Forward Reverse
1 18S 18S ribosomal RNA gene (reference gene) CGATGCGGCGGCGTTATTC TCTGTCAATCCTGTCCGTGTCC
2 ACAN AGGRECAN core protein CATCACTGCAGCTGTCAC AGCAGCACTACCTCCTTC
3 col1A2 collagen 1 A2 GTGGCAGTGATGGAAGTG CACCAGTAAGGCCGTTTG
4 col2A1 collagen 2 A1 AGCAAGAGCAAGGAGAAG GGGAGCCAGATTGTCATC
5 Hs Col 10a1 Collagen X A1 GAATGCCTGTGTCTGCTT TCATAATGCTGTTGCCTGTTA
6 CLIC3 Chloride intracellular channel 3 CTGCCCATCCTGCTCTAT CAGCGTCTCCTCCAGAAA
7 CA12 carbonic anhydrase XII (CA12), transcript variant 1 TGGAATCAGAATTGGAATCAC GACACAGCAACAACACAT
8 FOXF1 FOXF1 forkhead box F1 ATGTTCCTCCTCTTCCTT GACCAGAAAGTTTACAGTAGA
9 GPC3 Glypican 3 (cell surface heparan sulfate proteoglycan GAGACTGCGGTGATGATGAAG TCGGAGTTGCCTGCTGAC
10 Hs GDF5 Growth and Differntiation Factor 5 ATCAGCATCCTCTTCATTGACTCT ACACGACTCCACGACCAT
12 JPH3 Junctophilin 3 GAGGAGAATGGGGATGAG TCCGATGTTGAGCAAGAT
13 KRT19 Keratin 19 TGTGTCCTCGTCCTCCTC GCGGATCTTCACCTCTAGC
14 NCAM1 neural cell adhesion molecule 1 CTCACCATCTATAACGCCAACATC GCCTCTGACTCACTGCCATC
15 PAX1 Homo sapiens paired box 1 TAGTCCTCTATATGCTATCAG CTTGACAGTAGAACCAGA
16 SOX9 transcription factor SOX9 GAGACTTCTGAACGAGAG GGCTGGTACTTGTAATCC
17 Versican Versican, Variant 4 GTCTCCTCCTCGGCTCTG ACCTAATGTTCTCGGCTGTTG