Table 2: Sequences of primers used in SOX2 and OCT4 methylation-specific PCR

Primer Primer sequence (5 to 3) Product size (bp) References
SOX2 promoter MSP-Methylated
Forward TGTTTATTTATTTTTTTCGAAAAGGCG 206 [36]
Reverse GAACCCAACCTCGCTACCGAA
SOX2 promoter MSP-Unmethylated
Forward TGTTTATTTATTTTTTTTGAAAAGGTG 208 [36]
Reverse CTCAAACCCAACCTCACTACCAA
OCT4 promoter MSP-Methylated
Forward CGGGATATTTGGTTTCGGATTTC 209 [37]
Reverse CCCACAAAACTCATACGACGA
OCT4 promoter MSP-Unmethylated
Forward TGGGATATTTGGTTTTGGATTTT 210 [37]
Reverse CCCCACAAAACTCATACAACAAA