Table 1: SNP coding region, primer sequences and final concentration for PCR amplification (according to Alvarez-Iglesias et al [19]).

Nucleotide Position

Primer Sequences (53)

Amplicon length (bp)

Final Concentration (M)

Annealing Temperature (C)

1119

GCTAAGACCCAAACTGGGATT

GTTCTGGCGAGCAGTTTTGT

84

0.5

56

2092

TGCCCACAGAACCCTCTAAA

TGTCCAAAGAGCTGTTCCTCT

69

0.5

60

4491

ATTAATCCCCTGGCCCAAC

GATGAGTGTGCCTGCAAAGA

56

0.2

57

5417

CCTCAATCACACTACTCCCCATA

GGGGTGGGTTTTGTATGTTC

72

0.5

56

8281-8289del

TAGGGCCCGTATTTACCCTAT

AAGAGGTGTTGGTTCTCTTAATCTTT

109

0.5

55

8414

TACTACCGTATGGCCCACCA

GGGAGGTAGGTGGTAGTTTGTG

96

0.2

57

9824

TTTTGTAGCCACAGGCTTCC

GAGGAAAGTTGAGCCAATAATGA

53

0.4

56

13759

GGAAGCCTATTCGCAGGATT

GTTGTTTGGAAGGGGGATG

64

0.4

57

12705

CCCAAACATTAATCAGTTCTTCAA

TCTCAGCCGATGAACAGTTG

102

0.4

56