Table 2: SNP coding region, primer extension sequences and final concentration for minisequencing reaction (according to Alvarez-Iglesias et al [19]).

Nucleotide Position

Extension primer1 (53)

Length (bp)

Base substitution

Strand2

Final Concentration (M)

1119

(gact)8 gttagccctaaacctcaacagttaaa

58

TC

L

0.40

2092

(gact)4 ACCCTCTAAATCCCCTTGTAAATTTAA

43

CT

L

0.50

4491

CCTGCAAAGATGGTAGAGTAGATGA

25

GA

H

0.20

5417

(gact)9 CCATATCTAACAACGTAAAAATAAAATGACA

67

GA

L

0.40

8281-8289del

(gact)8 GACGTATTTACCCTATAGCACCCCCTCTA

61

CG3

L

0.30

8414

(gact)3 GACGCCCACCATAATTACCCCCATA

37

CT

L

0.20

9824

(gact)3 GCACAGGCTTCCACGGACT

31

TC

L

0.20

13759

(gact)4 GATCATTACTAACAACATTTCCCC

40

GA

L

0.15

12705

(c)17 AACATTAATCAGTTCTTCAAATATCTACTCAT

49

TC

L

0.30

 

1Italic indicates the non-homologous tails.

2Strand refers to the target DNA chain for SNP genotyping

39bp deletion (8281-8289del) is interrogated as a C to G change.